Doğru, SüleymanŞen, Ece2019-11-142019-11-1420192019https://hdl.handle.net/20.500.14551/4552Bu çalışmada, Edirne’deki çevresel sulardan alınan su numunelerinde ve çevresel sularda yaşayan kurbağalarda Leptospira sp. cinsi bakterilerin varlığı araştırılmıştır. Çevresel sulardan alınan 44 su numunesinde ve 100 kurbağa böbreğinde alınan doku örneklerinde moleküler ve bakteriyolojik yöntemler kullanılarak patojen bakteriler araştırılmıştır. Ayrıca karanlık alan mikroskopisi ile Leptospira sp. cinsi bakteriler saptanmıştır. 5-FU içeren EMJH besiyerinde kültürü yapılan bakteriler giemsa yöntemi ile boyanmıştır. Su numunelerinin membran filtrasyon yöntemi ile çalışılarak hazırlanan kültürlerin karanlık alan mikroskopisi ile değerlendirilmesinde 44 su numunesinin sadece 1’ inde (%2,27) Leptospira spp. tespit edilmiştir. Kurbağa böbreğinden alınan doku örneklerinden yapılan kültürlerin karanlık alan mikroskobunda değerlendirilmesi sonucu 100 adet kurbağa böbreğine ait kültürden 7’sinde (%7) Leptospira spp. tespit edilmiştir. Leptospira spp. tespit edilen toplam 8 kültürden hazırlanan preperatlar Giemsa yöntemi ile boyanarak spiroketler ışık mikroskobu ile görüntülenmiştir. Leptospira tespit edilen 8 adet kültürden izole edilen DNA’lar sec Y (preprotein translocase for Leptospira) proteinini kodlayan gen bölgesine ait primerler (GCGATTCAGTTTAATCCTGC ve GAGTTAGAGCTCAAATCTA) kullanılarak Real-Time PCR ile çoğaltılmıştır. Bu çalışma ile ilk kez Edirne ve çevresindeki sularda ve bu sularda yaşayan kurbağalarda non-patojen, saprofit Leptospira cinsi spiroketlerin varlığı gösterilmiştir.In this study, presence of bacteria of the genus Leptospira were investigated in surface water and frog tissue samples collected from Edirne and surroundings. By using the dark field microscopy, Giemsa staining and by inoculating EHJH medium with 5-FU, presence of Leptospira were investigated. Cultivated bacteria were genotyping by using the RT-PCR technique and species-specific probes to determine the pathogenic Leptospira interrogans complex. As a result, when water samples were prepared by the membrane filtration method and evaluated by dark field microscopy, only 1 'of water samples (2,27%) were contained Leptospira spp. Also cultured frog kidney samples were evaluated in the dark field microscope. Seven (7%) of the frog kidney sampels belonging to the frog kidney were found to be positive for Leptospira. Bacterie were stained from positive cultures by using Giemsa method. DNA sampeles isolated from 8 leptospira cultures were amplified by Real-Time PCR using the gene locus primers (GCGATTCAGTTTAATCCTGC and GAGTTAGAGCTCAAATCTA) encoding the sec-Y (preprotein translocase for Leptospira) protein. Pathogen Leptospira interrogans was not found in the study. First time, in this study, non- patogenic, saprophitic Leptospira genus spirochetes were demonstrated in surface waters and frog tissue samples in Edirne and surrounding.trinfo:eu-repo/semantics/openAccessLeptospiraLeptospirozEdirneRT-PZRKaranlık Alan MikroskopisiLeptospiraLeptospirosisRT-PCRDark Field MicroscopyEdirne ve çevresinde Leptospira cinsi bakterilerin araştırılmasıInvestigation of the genus Leptospira in Edirne and surroundingsMaster Thesis538889